PCR Primer information

The following table contains a list of pairs of PCR primers used in quantitative PCR reactions performed by the DBE group. These primers have been optimized for quantitative assessment of mRNA expression under the given conditions. In our quantitative PCR reactions we use NucleoSpin® RNA II, RNA isolation kit (Cat no: 740955.50) from Macherey-Nagel GmbH & Co. KG. The quantitative PCR reactions are run on a BIORAD CFX Connect™ Real-Time PCR Detection System.

Name

Description

Direction

Sequence

Product Size

Annealing temp

Hum ACAN

Human aggrecan

For

5' AGGCAGCGTGATCCTTACC 3'

136 bp

60

Rev

5' GGCCTCTCCAGTCTCATTCTC 3'

Hum Col1A1

Human Collagen,type I A1

For

5' GTCACCCACCGACCAAGAAACC 3'

121 bp

60

Rev

5' AAGTCCAGGCTGTCCAGGGATG 3'

Hum Col2A1

Human Collagen, type II A1

For

5' CGTCCAGATGACCTTCCTACG 3'

122 bp

60

Rev

5' TGAGCAGGGCCTTCTTGAG 3'

Hum Col9

Human Collagen, type IX

For

5' AGGACACAAGGGTGAAGAAGGT 3'

177 bp

60

Rev

5' TTTTCCCCTTTGTCCCCAACTATG 3'

Hum Col10A1

Human Collagen, type X A1

For

5' GCAACTAAGGGCCTCAATGG 3'

129 bp

60

Rev

5' CTCAGGCATGACTGCTTGAC 3'

Hum ActB

Human Beta-Actin

For

5' ACTCTTCCAGCCTTCCTTC 3'

88 bp

60

Rev

5' GATGTCCACGTCACACTTC 3'

Hum B2M

Human Beta-2-Microglobulin

For

5' GACTTGTCTTTCAGCAAGGA 3'

106 bp

60

Rev

5' ACAAAGTCACATGGTTCACA 3'

Hum GAPDH

Human Glyceraldehyde-3-Phosphate Dehydrogenase

For

5' CGCTCTCTGCTCCTCCTGTT 3'

81 bp

60

Rev

5' CCATGGTGTCTGAGCGATGT 3'

Hum Sox9

Human SRY (Sex Determining Region Y)-Box 9

For

5' TGGGCAAGCTCTGGAGACTTC 3'

98 bp

60

Rev

5' ATCCGGGTGGTCCTTCTTGTG 3'

Hum Twist1

Human Twist Basic Helix-Loop-Helix Transcription Factor 1

For

5' TGCCAATCAGCCACTGAAAGG 3'

125 bp

60

Rev

5' TTTGCAGGCCAGTTTGATCCC 3’

Hum c-Jun

Human Mitogen-Activated Protein Kinase 9

For

5' TCGACATGGAGTCCCAGGA 3'

101 bp

60

Rev

5' GGCGATTCTCTCCAGCTTCC 3'

Hum c-Myc

Human v-myc myelocytomatosis viral oncogene homolog

For

5' CAGCTGCTTAGACGCTGGATT 3'

131 bp

60

Rev

5' GTAGAAATACGGCTGCACCGA 3'

Hum CCND1

Human Cyclin D1

For

5' GCTGCTCCTGGTGAACAAG 3'

145 bp

60

Rev

5' ACAGAGGGCAACGAAGGTC 3'

Hum CBP

Human CREB binding protein (CREBBP), transcript variant 1

For

5' TGAGACCCTAACGCAGGTTT 3'

117 bp

60

Rev

5' GGCTGTCCAAATGGACTTGT 3'

Hum p300

Human E1A binding protein p300

For

5' TAAACTCTCATCTCCGGCCC 3'

129 bp

60

Rev

5' CCACCATTGGTTAGTCCCAA 3'

Hum PPARG

Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 3

For

5' GATGTCTCATAATGCCATCAGGTT 3'

96 bp

60

Rev

5' GGATTCAGCTGGTCGATATCACT 3'

Hum Nanog

Human Nanog homeobox

For

5' GATTTGTGGGCCTGAAGAAA 3'

119 bp

60

Rev

5' CAGGGCTGTCCTGAATAAGC 3'

Hum Oct4

Human POU class 5 homeobox 1 (POU5F1), transcript variant 1

For

5' CGTGAAGCTGGAGAAGGAGA 3'

137 bp

60

Rev

5' CATCGGCCTGTGTATATCCC 3'

Hum Sox2

Human SRY (sex determining region Y)-box 2

For

5' ATGCACAACTCGGAGATCAG 3'

130 bp

60

Rev

5' TATAATCCGGGTGCTCCTTC 3'

Hum Runx2

Human runt-related transcription factor 2 (RUNX2), transcript variant 4

For

5' GGAGTGGACGAGGCAAGAGTTT 3'

133 bp

60

Rev

5' AGCTTCTGTCTGTGCCTTCTGG 3'

Hum Osx

Human Sp7 transcription factor (SP7), transcript variant 1

For

5' GAAGGGAGTGGTGGAGCCAAAC 3'

102 bp

60

Rev

5' ATTAGGGCAGTCGCAGGAGGAG 3'

Hum MMP1

Human matrix metallopeptidase 1 (interstitial collagenase) (MMP1), transcript variant 2

For

5' GGGAGATCATCGGGACAACTC 3'

72 bp

60

Rev

5' GGGCCTGGTTGAAAAGCAT 3'

Hum MMP3

Human matrix metallopeptidase 3 (stromelysin 1, progelatinase)

For

5' TGGCATTCAGTCCCTCTATGG 3'

116 bp

60

Rev

5' AGGACAAAGCAGGATCACAGTT 3'

Hum MMP7

Human matrix metallopeptidase 7 (matrilysin, uterine)

For

5' GGGACTCCTACCCATTTG 3'

103 bp

60

Rev

5' CAGCGTTCATCCTCATCG 3'

Hum MMP9

Human matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

For

5' GGTGATTGACGACGCCTTTGC 3'

115 bp

60

Rev

5' CGCGACACCAAACTGGATGAC 3'

Hum MMP13

Human matrix metallopeptidase 13 (collagenase 3)

For

5' AAGGAGCATGGCGACTTCT 3'

72 bp

60

Rev

5' TGGCCCAGGAGGAAAAGC 3'

Hum ADAMTS2

Human ADAM metallopeptidase with thrombospondin type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA

For

5' TCGGGAGCTGTCTCTACGTC 3'

134 bp

60

Rev

5' CTTCTCCAAGGGTTCGATGA 3'

Hum ADAMTS4

Human ADAM metallopeptidase with thrombospondin type 1 motif, 4

For

5' CAAGGTCCCATGTGCAACGT 3'

115 bp

60

Rev

5' CATCTGCCACCACCAGTGTCT 3'

Hum ADAMTS5

Human ADAM metallopeptidase with thrombospondin type 1 motif, 5

For

5' TGGCTCACGAAATCGGACA 3'

74 bp

60

Rev

5' GGAACCAAAGGTCTCTTCACAGA 3'

Hum ADAMTS9

Human ADAM metallopeptidase with thrombospondin type 1 motif, 9

For

5' GCGTGTTGTTGTATGTCAGG 3'

87 bp

60

Rev

5' TCACAGGCTCTTTGCTCATC 3'

Hum TIMP3

Human TIMP metallopeptidase inhibitor 3

For

5' CCAGGACGCCTTCTGCAAC 3'

71 bp

60

Rev

5' CCTCCTTTACCAGCTTCTTCCC 3'

Hum ITGB1

Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) (ITGB1), transcript variant 1A

For

5' CAAAGGAACAGCAGAGAAGC 3'

168 bp

60

Rev

5' ATTGAGTAAGACAGGTCCATAAGG 3'

Hum BMP2

Human bone morphogenetic protein 2

For

5' GCTAGACCTGTATCGCAGGC 3'

74 bp

60

Rev

5' TTTTCCCACTCGTTTCTGGT 3'

Hum BMP4

Human bone morphogenetic protein 4

For

5' AGCGTAGCCCTAAGCATCAC 3'

102 bp

60

Rev

5' AGTCATTCCAGCCCACATCG 3'

Hum BMP6

Human bone morphogenetic protein 6

For

5' CATGAGCTTTGTGAACCTGG 3'

106 bp

60

Rev

5' CACCTCACCCTCAGGAATCT 3'

Hum ALPL

Human alkaline phosphatase, liver/bone/kidney (ALPL), transcript variant 1

For

5' ACAAGCACTCCCACTTCATC 3'

112 bp

60

Rev

5' TTCAGCTCGTACTGCATGTC 3'

Hum Wnt1

Human wingless-type MMTV integration site family, member 1

For

5' CTTCGGCAAGATCGTCAACC 3'

120 bp

60

Rev

5' GTGCAGGATTCGATGGAACC 3'

Hum Wnt3

Human wingless-type MMTV integration site family, member 3

For

5' CTTCTAATGGAGCCCCACCT 3'

125 bp

60

Rev

5' GAGCCCAGAGATGTGTACTGC 3'

Hum Wnt3A

Human wingless-type MMTV integration site family, member 3A

For

5' GGCTGTTGGGCCACAGTATTCC 3'

118 bp

60

Rev

5' GCTGGGCATGATCTCCACGTAG 3'

Hum Wnt4

Human wingless-type MMTV integration site family, member 4

For

5' CTCGTCTTCGCCGTCTTCT 3'

101 bp

60

Rev

5' AGTTTCTCGCACGTCTCCTC 3'

Hum Wnt 5A

Human wingless-type MMTV integration site family, member 5A,  transcript variant 1

For

5’ ATCAATTCCGACATCGAAGG 3’

129 bp

60

Rev

5’ CGTTCACCACCCCTGCT 3’

Hum Wnt5B

Human wingless-type MMTV integration site family, member 5B, transcript variant 2

For

5' TCAAGAGAGCGAGAAGACTGG 3'

150 bp

60

Rev

5' GTCTGTCAGAAGCTGAGCCC 3'

Hum Wnt7A

Human wingless-type MMTV integration site family, member 7A

For

5' TGCCCGGACTCTCATGAAC 3'

128 bp

60

Rev

5' GTGTGGTCCAGCACGTCTTG 3'

Hum Wnt7B

Human wingless-type MMTV integration site family, member 7B

For

5' AGCCAACATCATCTGCAACA 3'

130 bp

60

Rev

5' CTGGTACTGGCACTCGTTGA 3'

Hum Wnt9A

Human wingless-type MMTV integration site family, member 9A

For

5' GCAAGATGCTGGATGGGTC 3'

131 bp

60

Rev

5' GAGGATGGTCAGGGGCTC 3'

Hum Wnt10A

Human wingless-type MMTV integration site family, member 10A

For

5' TCCCCTATGAGAGTCCCATCT 3'

129 bp

60

Rev

5' AGCCACAGGCCTTCAGTTT 3'

Hum Wnt10B

Human wingless-type MMTV integration site family, member 10B

For

5' GGTCCACGAGTGTCAGCAC 3'

124 bp

60

Rev

5' GGAAAAAGCACTTTCTCGGA 3'

Hum Wnt11

Human wingless-type MMTV integration site family, member 11

For

5’GCTCCTCCTGGGTGTGAC 3’

146 bp

60

Rev

5’GATGGTGTCTTGGACAGCG 3’

Hum FZD8

Human frizzled family receptor 8

For

5' TCTACCTCTTCATCGGCACC 3'

123 bp

60

Rev

5' GGATCATCAGCTTCTCCAGC 3'

Hum WISP1

Human WNT1 inducible signaling pathway protein 1, transcript variant 2

For

5' GTCTCCACTCGGATCTCCAATG 3'

135 bp

55

Rev

5' CTGGTACACAGCCAGACACTTC 3'

Hum WISP2

Human WNT1 inducible signaling pathway protein 2

For

5' TCTGGCCTTGTCTCTTCCC 3'

125 bp

60

Rev

5' CAGAAGCGGTTCTGGTTGG 3'

Hum Ror2

Human receptor tyrosine kinase-like orphan receptor 2

For

5' GCTTCTGCTCTCAGTGTCCC 3'

108 bp

60

Rev

5' CCTTTCAGAGTTGGAATCGG 3'

Hum Ryk

Human receptor-like tyrosine kinase (RYK), transcript variant 2

For

5' TCTCTACCTGAGCGAGGACG 3'

145 bp

60

Rev

5' CCAGGTGAAGTGCAGGAAAT 3'

Hum Axin2

Human axin 2

For

5' AGTGTGAGGTCCACGGAAAC 3'

103 bp

60

Rev

5' CTGGTGCAAAGACATAGCCA 3'

Hum CatnB1

Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 2

For

5' CCAGGTGGTGGTTAATAAGG 3'

88 bp

60

Rev

5' CTGAGGAGAACGCATGATAG 3'

Hum TCF1

Human HNF1 homeobox A

For

5' AGGAGTGCAATAGGGCGGAATG 3'

113 bp

60

Rev

5' CCGGTTGGCAAACCAGTTGTAG 3'

Hum TCF3

Human transcription factor 3 (TCF3), transcript variant 2

For

5' GCACTGGCCTCGATCTACTC 3'

148 bp

60

Rev

5' CGTCGTAGCTGGGCGATAAG 3'

Hum FZD9

Human frizzled family receptor 9

For

5' CTGCATCCCCTAGAGACAGC 3'

114 bp

60

Rev

5' CCATCTCCCCTAATGAGCCT 3'

Hum TCF4

Human transcription factor 4 (TCF4), transcript variant 12

For

5' GCACTGCCGACTACAATAGG 3'

150 bp

60

Rev

5' CTGCATAGCCAGGCTGATTC 3'

Hum LEF1

Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 3

For

5' CGAAGAGGAAGGCGATTTAG 3'

109 bp

60

Rev

5' CTGAGAGGTTTGTGCTTGTC 3'

Hum GSK3B

Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 2

For

5' CGCTCCCTGTGATTTATG 3'

129 bp

55

Rev

5' TATCCCGATGGCAGATTC 3'

Hum APC

Human adenomatous polyposis coli (APC), transcript variant 3

For

5' TGTCCCTCCGTTCTTATGGAA 3'

89 bp

60

Rev

5' TCTTGGAAATGAACCCATAGGAA 3'

Hum ICAT

Human catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 1

For

5' TGCTCATGCTGCGGAAGATGGG 3'

145 bp

60

Rev

5' AACGCCATCACCACGTCCTCTG 3'

Hum WIF1

Human WNT inhibitory factor 1

For

5' TCAGAAAAGCGCAACAGAGA 3'

132 bp

60

Rev

5' TGATGCCTTTATCCAGGGAG 3'

Hum SFRP1

Human secreted frizzled-related protein 1

For

5' TTCCTCTGCTCGCTCTTCG 3'

132 bp

60

Rev

5' AAGCATCTCGGGCCAGTAG 3'

Hum FZD4

Human frizzled family receptor 4

For

5' AACTTTCACACCGCTCATCC 3'

134 bp

60

Rev

5' TGACTGAAAGACACATGCCG 3'

Hum DKK1

Human dickkopf WNT signaling pathway inhibitor 1

For

5' AGTACTGCGCTAGTCCCACC 3'

172 bp

60

Rev

5' TCCTCAATTTCTCCTCGGAA 3'

Hum Grem1

Human gremlin 1, DAN family BMP antagonist (GREM1), transcript variant 2

For

5' GTCACACTCAACTGCCCTGA 3'

375 bp

60

Rev

5' GGTGAGGTGGGTTTCTGGTA 3'

Hum FGFBP2

Human fibroblast growth factor binding protein 2

For

5' GGAGGGAATGAGGAAGCAAAG 3'

79 bp

60

Rev

5' TGATGAGAAAGGCGCACAG 3'

Hum FGFR3

Human fibroblast growth factor receptor 3 (FGFR3), transcript variant 3

For

5' CCAGCAGGAGCAGTTGGTCTTC 3'

105 bp

60

Rev

5' GTGCCATCCTTGACCCAGACAG 3'

Hum PTH1R

Human parathyroid hormone 1 receptor (PTH1R), transcript variant 2

For

5' CGCCTGGGCATGATTTACAC 3'

142 bp

60

Rev

5' GCAGCATGAAGGACAGGAAC 3'

Hum Notch3

Human notch 3

For

5' GTGTGCAAATGGAGGTCGTT 3'

145 bp

60

Rev

5' TGAACTCTGGCAGACACCAC 3'

Hum NFkB1

Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1), transcript variant 2

For

5' ATGTATGTGAAGGCCCATCC 3'

105 bp

60

Rev

5' TTGCTGGTCCCACATAGTTG 3'

Hum RelA

Human v-rel reticuloendotheliosis viral oncogene homolog A (avian) (RELA), transcript variant 4

For

5' CTGCCGGGATGGCTTCTAT 3'

91 bp

60

Rev

5' CCGCTTCTTCACACACTGGAT 3'

Hum CCL8

Human chemokine (C-C motif) ligand 8

For

5' AGATGAAGGTTTCTGCAGCG 3'

110 bp

60

Rev

5' AAAGCAGCAGGTGATTGGAA 3'

Hum TNFAIP6

Human tumor necrosis factor, alpha-induced protein 6

For

5' AAGGATGGGGATTCAAGGAT 3'

99 bp

60

Rev

5' GCTTGTATTTGCCAGACCGT 3'

Hum IL1B

Human interleukin 1, beta

For

5' TCCCCAGCCCTTTTGTTGA 3'

91 bp

60

Rev

5' TTAGAACCAAATGTGGCCGTG 3'

Hum IL6

Human interleukin 6 (interferon, beta 2)

For

5' GGCACTGGCAGAAAACAACC 3'

85 bp

60

Rev

5' GCAAGTCTCCTCATTGAATCC 3'

Hum IL8

Human interleukin 8

For

5' CTGGCCGTGGCTCTCTTG 3'

69 bp

60

Rev

5' CCTTGGCAAAACTGCACCTT 3'

Hum IL11

Human interleukin 11 (IL11), transcript variant 1

For

5' TCTCTCCTGGCGGACACG 3'

79 bp

60

Rev

5' AATCCAGGTTGTGGTCCCC 3'

Hum SERPINA1

Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 (SERPINA1), transcript variant 11

For

5' AGTTCGCCTTCAGCCTATACC 3'

149 bp

60

Rev

5' ATTCAGGCCCTCCAGGATTTC 3'

Hum SERPINA3

Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3

For

5' AAGGACCTTGACTCGCAGAC 3'

140 bp

60

Rev

5' ATGGGCACCATTACCCACT 3'

Hum SERPINA5

Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 

For

5' TGCCATGAAGACGCTGTACC 3'

150 bp

60

Rev

5' ACGACCGCATTGCTATCGAG 3'

Hum SERPINE1

Human serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 

For

5' AGAAACCCAGCAGCAGATTC 3'

125 bp

60

Rev

5' TGGTGCTGATCTCATCCTTG 3'

Hum VEGFC

Human vascular endothelial growth factor C

For

5' CTGTGGCGTGTTCTCTGCT 3'

149 bp

60

Rev

5' CTCCAGATCTTTGCTTGCAT 3'

Hum VCAN

Human versican (VCAN), transcript variant 4

For

5' CCCATGCGCTACATAAAGTC 3'

115 bp

60

Rev

5' TAACTGGGTGGCAAAGTAGG 3'

Hum IGFBP4

Human insulin-like growth factor binding protein 4

For

5' CCTGCACACACTGATGCAC 3'

125 bp

60

Rev

5' AGGGGCTGAAGCTGTTGTT 3'

Hum SMAD3

Human SMAD family member 3 (SMAD3), transcript variant 1

For

5' TCAACACCAAGTGCATCACC 3'

91 bp

60

Rev

5' CGGCAGTAGATGACATGAGG 3'

Hum PANX3

Human pannexin 3

For

5’ GGGACTCACTGCTTCACCAT 3’

172 bp

60

Rev

5’ AACAGCAGATCGGAGCTGAG 3’

Hum MATN1

Human matrilin 1, cartilage matrix protein

For

5’ TCCTCTCTGGCACTAGCCTC 3’

142 bp

60

Rev

5’ CGAGAGCTGTCGACAACAAA 3’

Hum EPYC

Human epiphycan

For

5’ GCAGGACTTGTTCTGGGACT 3’

191 bp

60

Rev

5’ TCTCTGTTCCCTGAAGGCAT 3’

Hum LEF1

Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 3

For

5’ GGAAGGCGATTTAGCTGACA 3’

133 bp

60

Rev

5’ GTGTTCTCTGGCCTTGTCGT 3’

Hum FRZB

Human frizzled-related protein

For

5’ ACGGGACACTGTCAACCTCT 3’

155 bp

60

Rev

5’ CGAGTCGATCCTTCCACTTC 3’

Hum COL3A1

Human collagen, type III, alpha 1

For

5’ ATGCCCTACTGGTCCTCAGA 3’

151 bp

60

Rev

5’ GGAACCAGGATGACCAGATG 3’

Hum EMILIN1

Human elastin microfibril interfacer 1

For

5’ AGGATCACCAGGCAAGGAC 3’

119 bp

60

Rev

5’ GAGCAGCTGAAAATGCCACT 3’

Hum COL5A2

Human collagen, type V, alpha 2

For

5’ GGCAGTGTAGGAGAAGCAGG 3’

165 bp

60

Rev

5’ AGCCGCCTGATCTTCAGTAA 3’

Hum ABI3BP

Human ABI family, member 3 (NESH) binding protein

For

5’ AAAGCTCCACTGGGAGGAGT 3’

194 bp

60

Rev

5’ GTGGGTCGTGCTGAGATTTT 3’

Hum CHRDL2

Human Chordin-Like 2

For

5’ GCCTGCTATGCTCAGTCAGTG 3’

158 bp

60

Rev

5’ TCTGAAGTGGCGAGGGATGAA 3’

Hum COL2A1 (2)

Human specific Collagen2A1, non bovine

For

5’ ACGAGGCCTGACAGGTCCCA 3’

161 bp

60

Rev

5’ GCCCAGCAAATCCCGCTGGT 3’

Hum ACAN (1)

Human specific Aggrecan, non bovine

For

5’ CAGCCACCACCTACAAACGCAG 3’

150 bp

60

Rev

5’ CTGGGTGGGATGCACGTCAGC 3’